Single nucleotide polymorphism in growth hormone gene exon-4 and exon-5 using PCR-SSCP in Black Bengal goats – A prolific meat breed of India

Please download to get full document.

View again

All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
 18
 
  Single nucleotide polymorphism in growth hormone gene exon-4 and exon-5 using PCR-SSCP in Black Bengal goats – A prolific meat breed of India
Share
Transcript
  Single nucleotide polymorphism in growth hormone gene exon-4and exon-5 using PCR-SSCP in Black Bengal goats – A prolificmeat breed of India Neelam Gupta  a,* , S.P.S. Ahlawat  b , D. Kumar  a , S.C. Gupta  a ,Alok Pandey  a , Geetu Malik  a a Transgenic Research Laboratory, DNA Fingerprinting Unit, National Bureau of Animal Genetic Resources,P.O. Box No. 129, Baldi By Pass, Karnal 132 001, India b Director National Bureau of Animal Genetic Resources, P.O. Box No. 129, Baldi by Pass, Karnal 132 001, India Received 19 October 2006; received in revised form 2 February 2007; accepted 2 February 2007 Abstract Single-strand conformation polymorphism (SSCP) showed 7 and 5 haplotypes in caprine GH gene exon-4 and exon-5 in Black Ben-gal, a prolific meat breed from India. All haplotypes revealed novel sequences. In exon-4 codons 6, 36 and 54 were polymorphic. Atcodon 6, AA arginine (R) changed to histidine (H) and proline (P), showing 6RR, 6HH and 6PP genotypes. At codons 36 three geno-types DD, VV and DV were observed due to SNP showing changed from aspartic acid (D) to valine (V). At codon 54, AA change fromarginine to tryptophan (W) and 54RR and 54WW genotypes were observed. SNPs were also observed at codon 23 (serine to threonine)and at 37 (arginine to proline) in 8% of goats. In exon-5 nucleotide substitution (G/A) at codon 10 and (A/G) at 14 respectively changedAA from glycine (K) to glutamic acid (E). Silent mutations were also observed.   2007 Elsevier Ltd. All rights reserved. Keywords:  Caprine; Growth hormone; Single-strand conformation polymorphism; Single nucleotide polymorphism; India 1. Introduction Application of molecular genetics for genetic improve-ment relies on the ability to genotype individuals for spe-cific genetic loci. Single nucleotide polymorphisms (SNP)are the class of direct markers that locate the loci that codefor the functional mutation, have the edge over othermarkers, viz., linkage disequilibrium (LD) with functionalmutations and population-wide linkage equilibrium (LE)markers (Andersson, 2001). Main application and poten-tial for use of markers to enhance genetic improvementin livestock is through within-breed selection (Dekker,2004). Selection of suitable candidate gene, depending onthe trait under selection, is very important. First of all poly-morphisms or markers need to be identified at the popula-tion level using random non-pedigreed samples. Analysis of marker-trait associations can bring a significant improve-ment for polygenic traits like milk yield, growth and meatproduction.The Black Bengal goat is a major meat producing ani-mal spread over vast geographic areas in the eastern regionof India, Bangladesh and other Southeast Asian countries(Acharya, 1982; Mason, 1981). This breed presents a widespectrum of variability in phenotypes, colour pattern,growth and body size, milk yield and reproduction rateacross different regions (Bhattacharya, 2000). Despitehigher fecundity, the Black Bengal goat generally has a rel-atively low milk production, which is often insufficient forfeeding multiple kids (Chowdhury & Faruque, 2004).Improvement in milk production and growth rate is the 0309-1740/$ - see front matter    2007 Elsevier Ltd. All rights reserved.doi:10.1016/j.meatsci.2007.02.005 * Corresponding author. Tel.: +91 9416301144; fax: +91 184 2267654. E-mail address:  neelug@yahoo.com (N. Gupta). www.elsevier.com/locate/meatsci Meat Science 76 (2007) 658–665 MEATSCIENCE  major goal for which a suitable candidate marker needs tobe identified that can be correlated within the breed.Growth hormone (GH) is the major regulator of postnatal growth and metabolism in mammals and thus affectsgrowth rate, body composition, health, milk productionand aging by modulating the expression of many genes(Chung, Kim, & Lee, 1998; Etherton et al., 1986; Ho &Hoffman, 1993; Lincoln, Sinowatz, el-Hifnawi, Hughes,& Waters, 1995; Sumantran, Thailand, & Schwartz,1992). Growth hormone (GH) a single polypeptide hor-mone produced in the anterior pituitary gland is a promis-ing candidate gene marker for improving milk and meatproduction in goats and other farm animals (Min, Li,Sun, Pan, & Chen, 2004). Growth hormone gene isencoded by 1800 base pairs (bp), consisting of five exons,separated by four intervening sequences (Gordon, Quick,Erwin, Donclson, & Maurer, 1983). The intragenic haplo-types of growth hormone gene in bovines have beendescribed by Lagziel, Lipkin, and Soller (1996). Manypolymorphisms have been identified in the regulatory (pro-moter), UTRs and exons of GH gene, but few of these havebeen precisely characterized for nucleotide changes andtheir positions in the DNA sequence.Techniques have been described for the detection of point mutations in structural genes and their regulatorysequences. These are, denaturing gradient gel electropho-resis (DGGE) (Fischer & Lerman, 1980) and temperaturegradient gel electrophoresis (TGGE) (Riesner et al., 1989).Single-strand conformation polymorphism (SSCP) is apowerful method, based on the differential migration of single stranded molecules through polyacrylamide gelsbased on the effect of sequence variation on intra strandedloop formation, for the identification of variations at aparticular gene amplified product of DNA and has beenused for the detection of genetic mutations in humans(Orita, Suzuki, Kanawaza, Sakiya, & Hyashi, 1989), rats(Pravenec et al., 1992) and in various bacteriological(Morohoshi, Hayashi, & Munakata, 1991) and viralstrains (Fugita, Silver, & Pedea, 1992). The objective of this study was to identify the single nucleotide polymor-phism (SNP) in growth hormone gene exon-4 and exon-5 in the Black Bengal goat breed, which would form thebasis of a deeper study associating them with performancelevels for improving milk and meat productivity of thebreed. 2. Materials and methods  2.1. DNA extraction Fifty ‘‘Black Bengal’’ animals (8 males and 42 females)from farmer’s flocks were selected at random in the WestBengal (India) in 2004. Blood samples (10 ml) wereobtained by jugular venipuncture, using vacuum tubestreated with 0.25% EDTA. DNA extraction was performedwithin 24 h according to Sambrook, Fristsch, and Maniatis(1989) with minor modifications and checked for qualityand the quantity and was diluted to a final concentrationof 50 ng/ l l.  2.2. DNA amplification by PCR Polymerase chain reaction (PCR) was carried out onabout 50–100 ng genomic DNA in a 25  l l reaction vol-ume. The primers described by Barracosa (1996) givenin Table 1 of the exon-4 and exon-5 of growth hormonegene (Gene Bank D00476) of the goats were used (Kiokaet al., 1989).The amplified products of 225 bp and 365 bp respec-tively were expected to have a region from nucleotide1396 to nucleotide 1620 of the exon-4 and from nucleotide1795 to nucleotide 2159 corresponding to the exon-5 of caprine growth hormone gene. The reaction mixture con-sisted of 200  l M each of dATP, dCTP, dGTP and dTTP,50 mM KCl, 10 mM Tris–HCl (pH 9.0), 0.1% Triton X-100, 1.5 mM MgCl 2 , 0.75 U Taq DNA polymerase and4 ng/ l l of each primer (Sigma Genosys), two drops of min-eral oil, using PTC-200 PCR machine (M J Research Inc.,MA, USA). Following a hot start (95   C for 5 min), 30cycles were carried out (95   C for 30 s, 62   C for 30 s,72   C for 30 s), ending with a 5 min final extension at72   C. Amplification was verified by electrophoresis on2% (w/v) agarose gel in 1 ·  TAE buffer using a 100 bp lad-der (Invitrogen) as a molecular weight marker for confor-mation of the length of the PCR products. Gels werestained with ethidium bromide (1  l g/ml).  2.3. Single-strand conformation polymorphism analysis PCR products were resolved by SSCP analysis. Severalfactors were tested for each fragment in order to optimizethe amount of PCR products, denaturing solution, acryl-amide concentration, percentage cross linking, glycerol,voltage, running time, temperature. Each PCR productwas diluted in denaturing solution (95% formamide,10 mM NaOH, 0.05% xylene cyanol and 0.05% bromophe-nol blue, 20 mM EDTA) denatured at 95   C for 5 min,chilled on ice and resolved on a polyacrylamide gel. Theelectrophoresis was carried out in a vertical unit (Bio-Rad Protean II xi), in 1X TBE buffer. Silver staining wasas described by Sambrook et al. (1989). The gels were driedon cellophane paper using a gel dryer (Model 583, Bio-Rad).  2.4. PCR cleanup and DNA sequencing  The DNA samples showing different patterns on SSCPgels were selected for sequencing. The PCR products werepurified by PCR purification kits (Biogene). The ampliconsshowing clear bands on agarose were further purified usingExo-SAP treatment in 96 well formats. Duplicate sampleswere chosen for each variant for both GH-4 and GH-5 seg-ments of the caprine growth hormone gene. Primersused for sequencing were the same as those used for the N. Gupta et al. / Meat Science 76 (2007) 658–665  659  PCR-SSCP techniques. The PCR products were sequencedby ABI 3100 (Applied Biosystem, USA).  2.5. Sequence analysis Nucleotide sequence alignments, translations and com-parisons were carried out using the MEGALIGN softwaremodule of DNASTAR Version 4.0 (software of DNA-STAR, Inc., USA). The BLAST algorithm of NCBI(National Center for Biotechnology Information) was usedto search the NCBI GenBank (http://www.ncbi.nlm.hih.gov/) databases for homologous sequences. 3. Results and discussion The Black Bengal is a prolific and outstanding meat goatbreed of eastern India and adjoining countries in South-east Asia (Acharya, 1982). Milk production in this breedis of little economic value to the local people directly butit plays a great role in that the animals have a better moth-ering ability for raising multiple kids in a single litter. Theanimals are kept in small numbers by farmers, where pedi-gree records are impractical to maintain. It is widelyaccepted that the growth hormone gene affects the growthof body and udder development, and milk yield (Ho &Hoffman, 1993; Lincoln et al., 1995) and may thus be animportant candidate gene for improvement in the BlackBengal goat breed. Therefore, we considered it importantto screen the exon-4 and exon-5 of genomic DNA from thisbreed for the single nucleotide polymorphism. 3.1. Single-strand conformational polymorphism analysis Genetic variability in growth hormone genes wasassessed by SSCP technique, which allows the detectionof changes in the nucleotide sequence and a PCR-productis affected by single base substitution. Fig. 1 shows theSSCP band pattern for growth hormone gene exon-4.Seven haplotypes A, B, C, D, E, F, and G in frequenciesof 8%, 38%, 8%, 10%, 14%, 16%, and 6% were observed ingenomic DNA samples having parts of intron-3 near 5 0 ,intron-4 near 3 0 and complete cds of the exon-4 segmentof caprine growth hormone gene. The number of SSCPhaplotypes observed in this breed was much higher thanthe 2 in a Portuguese sheep breed Churra da Terra (Bastos,Cravador, Azevedo, & Guedes-Pinto, 2001). Five haplo-types A, B, C, D, and E (Fig. 2) in GH exon-5 were in fre-quencies of 38%, 40%, 8%, 10%, and 4%, respectively(Table 2). Bastos et al. (2001) also reported 5 PCR-SSCP patterns in the Portuguese sheep breed, Churra da TerraQuente in the GH exon-5 region. The higher level of genetic polymorphism observed in this breed could bebecause the samples were collected at random from theentire Black Bengal breeding area where little selection ispracticed while in the Portuguese study, the samples weretaken from only one flock. The advantage of using theSSCP technique is that by neutral polyacrylamide gel elec-trophoresis, we can separate two single stranded DNAfragments in which the nucleotide sequences differed atonly one position in fragments of genomic DNA (Hayashi,1991; Orita et al., 1989). 3.2. DNA sequence analysis The mega-align using DNASTAR 4.0 software, revealedcomplete homology with the deposited sequence of goat Table 1Details of growth hormone gene primers and conditions of SSCP analysisGene Size of PCR product Primer sequence Acrylamide (%) DNA ( l l) Denaturing solution ( l l) Time (h)GH (E4) 225 5 0 CCACCAACCACCCATCTGCC3 0 15 5 15 155 0 GAAGGGACCCAAGAACGCC3 0 GH (E5) 365 5 0 GAAACCTCCTTCCTCGCCC3 0 11 5 15 115 0 CCAGGGTCTAGGAAGGCACA3 0 Fig. 1. PCR-SSCP band pattern on a 15% non-denaturing polyacrylamidegel after 15 h of the run at 4   C. The seven haplotypes are namedalphabetically based on their electrophoretic mobility on the gel. In lane 2and lane 6 the haplotypes are similar, named as B type. The unique SSCPhaplotypes were approximately 225 bp covering partial intron-3 near5 0 UTR, complete CDs of exon-4 and partial intron-4 at 3 0 end of thegrowth hormone gene in Black Bengal goats.660  N. Gupta et al. / Meat Science 76 (2007) 658–665  growth hormone gene with Accession No. D00476 frombeginning to end, excepting SNPs at specific nucleotide.The PCR-SSCP analysis of exon-4 revealed seven distinctsequences (Genbank Accessions DQ196492, DQ196494– DQ196499). The general nucleotide profile correspondedto the sequence of GenBank (Accession No. D00476); how-ever, all sequences were distinct among themselves as wellas from the reference sequence (Fig. 3). Five uniquesequences of GH exon-5 (Fig. 4) were also distinct fromthe reference sequence (Accession No. D00476). Thisshows that the PCR-SSCP conformers identified on anon-denaturing gel represent point mutations in theirnucleotide sequence. Similar strategies have been used forSNP identification in the growth hormone gene of goatsby Min et al. (2004) and DQA2 gene by Zhou, Hickford, and Fang (2005). 3.3. Single nucleotide polymorphism in exon-4 of the growthhormone gene Three major codons 6, 36 and 54 revealed SNPs in goatgrowth hormone gene exon-4 in this study (Fig. 5).Sequencing of the haplotypes C and D revealed a G/A sub-stitution at nucleotide position 17 of the subjected sequence(GenBank Accession No. DQ196494–DQ196495), result-ing in the replacement of amino acid arginine (R) by histi-dine (H). Another substitution of G/C at this nucleotideposition in DQ196492 revealed a change to proline (P)from arginine (R) of the reference sequence. These muta-tions resulted in three genotypes at this codon, viz., 6RR,6HH and 6PP with frequencies of 0.76, 0.18 and 0.06,respectively. Such polymorphism has not been describedbefore in goats except in our earlier studies of SNPs inGaddi and Jamunapari goat breeds (unpublished data).At codon 23 another haplotype C with a frequency of 0.08% showed a nucleotide substitution G/C at the 68nucleotide position in the sequence (DQ196494). Thisnucleotide substitution resulted in an AA shift from serine(S) to threonine (T), giving rise to two genotypes 23SS and23TT with frequencies of 0.92 and 0.08 respectively (Table3). This SNP is new and has not been observed in otherindigenous goat breeds.Codon 36 (Table 4) is the other major SNP site in goatgrowth hormone exon-4, where A/G substitution in vari-ants DQ196495–DQ196497 and A/T in DQ196498 resultedin an AA change of aspartic acid (D) to glycine (G) andaspartic acid (D) to valine (V). As a result three genotypes36DD, 36GG and 36VV were present at frequencies of 0.54, 0.30 and 0.16 respectively. SNPs at this codon havebeen observed in Gaddi and Jamunapari goat breeds inour earlier study (unpublished data). At codon 37 G/C sub-stitution in DQ196494 resulted in an SNP with change of amino acid from arginine to proline. The genotypes at thislocus were 37RR and 37PP having frequencies of 0.90 and0.10 respectively. Fig. 2. PCR-SSCP band pattern on a 11% non-denaturing polyacrylamidegel after 11 h of run at 4   C. The five haplotypes are named alphabeticallybased on their electrophoretic mobility on the gel. The unique SSCPhaplotypes were approximately 365 bp covering partial intron-4 near5 0 UTR, complete CDs of exon-5 and part of 3 0 UTRs of the growthhormone gene in the Black Bengal goats.Table 2Genotypic frequency of SSCP variants of growth hormone gene exon-4 and exon-5 in Black Bengal goatsGH-exon-4 GH-exon-5Genotype No. Frequency (%) Genotype No. Frequency (%)A (DQ196492) 4 8.00 A (DQ015920) 19 38.00B (DQ196497) 19 38.00 B (DQ015921) 20 40.00C (DQ196494) 4 8.00 C (DQ016323) 4 8.00D (DQ196495) 5 10.00 D (DQ016031) 5 10.00E (DQ196496) 7 14.00 E (DQ016033) 2 4.00F (DQ196498) 8 16.00G (DQ196499) 3 6.0050 100.00 50 100.00Figures in parentheses indicate the GenBank accession number. N. Gupta et al. / Meat Science 76 (2007) 658–665  661  At codon 54, C/T nucleotide substitution caused AAshift from arginine (R) to tryptophan (W) in GenBankAccessions DQ196495–DQ196499. This non-synonymousmutation produced two homozygous genotypes 54RRand 54WW in Black Bengal goats with frequencies of 0.50 and 0.50 (Fig. 6) This type of SNPs at this codon Fig. 3. Phylogeny of growth hormone gene sequences (Accessions DQ196492–DQ196499) covering partial intron-3 near 5 0 UTRs, complete CDs of exon-4and part of intron-4 of Black Bengal goats were drawn using the Clustal W method of sequence alignment. The novel sequences revealed distinctrelationships amongst them as well as with the reference sequence D00476.Fig. 4. Phylogeny of growth hormone gene sequences (Accessions DQ015920–21, DQ016323, DQ016031, DQ016033) covering partial intron-4 near5 0 UTRs, complete CDs of exon-4 and part of 3 0 UTRs of Black Bengal goats were drawn using the Clustal W method of sequence alignment. The novelsequences revealed differences amongst the five haplotypes as well as from the reference sequence D00476.Fig. 5. Comparative alignment of the PCR-SSCP haplotypes sequence of 162 nucleotides only CDs of growth hormone gene in the Black Bengal goat withGenbank reference sequence D00476, based on Megalign module of DNAstar software version 4.0. Nucleotide positions 17, 68, 107, 110, 126, 153 and 160show nucleotide substitutions.Table 3Nucleotide substitutions and frequency of SNPs in exon-4 sequences of Black Bengal goatNucleotide substitution Codon no. AA change Type of SNP Frequency Accession numberG/A (17) 6 R  !  H Non-synonymous 0.18 DQ196494–95G/C (17) 6 R  !  P Non-synonymous 0.14 DQ196496G/C (68) 23 S  !  T Non-synonymous 0.08 DQ196494A/G (107) 36 D  !  G Non-synonymous 0.30 DQ196495–97A/T (107) 36 D  !  V Non-synonymous 0.16 DQ196498G/C (110) 37 R  !  P Non-synonymous 0.08 DQ196494G/A (126) 43 – Synonymous 1.00 DQ196492–99G/C (153) 51 – Synonymous 0.52 DQ196495–99C/T (160) 54 R  !  W Non-synonymous 0.52 DQ196495–99662  N. Gupta et al. / Meat Science 76 (2007) 658–665
Related Search
Similar documents
View more
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x