The human and mouse homologs of the yeast RAD52 gene: cDNA cloning, sequence analysis, assignment to human chromosome 12p12.2–p13, and mRNA expression in mouse tissues

Please download to get full document.

View again

All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
 16
 
  The human and mouse homologs of the yeast RAD52 gene: cDNA cloning, sequence analysis, assignment to human chromosome 12p12.2–p13, and mRNA expression in mouse tissues
Share
Transcript
  GENOMICS zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA 5, 199-206 (1995) The Human and Mouse Homologs of the Yeast RAD52 Gene: cDNA Cloning Sequence Analysis Assignment to Human Chromosome 12p12.2-~13 and mRNA Expression in Mouse Tissues zyxwvutsrqponmlkj ZHIYUAN SHEN,* KAREN DENISON,t REBECCA Loss,t JOE M. GATEWOOD,t AND DAVID J. CHEN*,’ LS-1, MS M888, and tLS-2, MS M880, Life Sciences Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 Received August 2, 1994; revised October 7, 1994 The yeast zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA accharomyces cerevisiae RAD52 gene is involved in DNA double-strand break repair and mi- totic/meiotic recombination. The N-terminal amino acid sequence of yeast S. cerevisiae Schizosaccharo- myces pombe and Kluyveromyces lactis and chicken is highly conserved. Using the technology of mixed oligo- nucleotide primed amplification of cDNA (MOPAC), two mouse RAD52 homologous cDNA fragments were amplified and sequenced. Subsequently, we have cloned the cDNA of the human and mouse homologs of yeast RAD52 gene by screening cDNA libraries using the identified mouse cDNA fragments. Sequence analy sis of cDNA derived amino acid revealed a highly con- served N-terminus among human, mouse, chicken, and yeast RAD52 genes. The human RAD52 gene was as- signed to chromosome 12p12.2-p13 by fluorescence in situ hybridization, R-banding, and DNA analysis of so- matic cell hybrids. Unlike chicken RAD52 and mouse RAD51, no significant difference in mouse RAD52 mRNA level was found among mouse heart, brain, spleen, lung, liver, skeletal muscle, kidney, and testis. In addition to an -1.9-kb RAD52 mRNA band that is present in all of the tested tissues, an extra mRNA spe- cies of -0.85 kb was detectable in mouse testis. 0 1995 Academic Press, Inc. INTRODUCTION Ionizing radiation causes different types of DNA damage. Misrepair or nonrepair of this damage may cause cell death, mutation, and neoplastic transforma- tion. Distinctive pathways of DNA repair that respond to different DNA damage may exist. In the yeast Sac- charomyces cerevisiae three epistasis groups of DNA damage-repair genes have been identified (Friedberg et al. 1991). The RAD52 epistasis group, which is mainly responsible for DNA double-strand break (DSB) repair, contains 8 genes: FWXO-RAD57. Several yeast genes Sequences presented in this report have been deposited with the GenBank database under Accession Nos. U12134 and U12135. 1 To whom correspondence should be addressed. Telephone: (505) 667-2789. Fax: (505) 665-3024. E-mail: DCHEN@TELOMER.LANL.- GOV. of the RAD52 group have been cloned, including R D51 (Basile et al. 1992; Shinohara et al. 19921, RAD52 @child et al. 1983; Adzuma et al. 1984), RAD54 (Em- ery et al. 19911, RAD55 (Lovett, 1994), and RAD57 (Kans et al. 1991). Y eas c ic , h k en, mouse, and human F 051 protein have a certain level of homology to the bacterial Ret-A protein, which is required for homolo- gous recombination (Yoshimura et al. 1993; Morita et al. 1993; Shinohara et al. 1992; Bezzubova et al. 1993a), as well as to a yeast meiosis-specific gene DMC- 1 (Bishop et al. 1992). Yeast RAD51, FUD55, and RAD57 are also homologous to each other in certain regions, especially in their nucleotide binding regions (Lovett, 1994; Kans et al. 1991). Yeast RAD51, RAD52, and FWD54 genes are induced during meiosis (Cole et al. 1989; Shinohara et al. 1992). Yeast RAD54 is also inducible by DNA damage agents (Cole et al. 1987; Emery et al. 1991). Chicken RAD5URAD52 (Bezzubova et al. 1993a,b) and mouse RAD51 are highly expressed in reproductive tissues such as testis and ovary. Mutation of the RAD52 gene results in reduced repair of double-strand breaks and abnormal DNA recombination (Boudy-Mills and Liv- ingston, 1993). The yeast RAD52 gene is also able to substitute for the phage T4 gene 46 in carrying out DNA repair and recombination (Chen and Bernstein, 1988). All of these studies suggest that genes in the RAD52 epistasis group are important not only for DNA damage repair but also for meiotic and mitotic recombi- nation. Although yeast RAD52 mRNA is not induced by X rays (Emery et al. 19911, and little or no RAD52-LacZ fusion protein induction by DNA damage can be de- tected (Cole et al. 19871, RAD52 is highly expressed in yeast meiosis (Cole et al. 1989). Chicken RAD52 mRNA is highly transcribed in reproductive tissue (Be- zzubova et al. 1993b). Yeast RAD52 protein also physi- cally interacts with RAD51 protein (Shinohara et al. 1992; Milne and Weaver, 1993), which is involved in ATP-dependent homologous DNA pairing and strand exchange (Sung, 1994). A third component may also be involved with the RAD51 and RAD52 complex (Milne and Weaver, 1993). Mutations in different regions of 199 0888-'7543/95 6.00 Copyright 0 1995 y Academic Press, Inc. All rights of reproduction in any form reserved.  200 zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA HEN ET AL. the RAD52 gene often result in different phenotypes (Boudy-Mills and Livingston, 1993). All of these fea- tures make RAD52 an interesting component in the DNA DSB repair pathway. It is predicted that RAD52 gene products play an essential role in the repair of DNA DBS and DNA recombination. All of the cloned S. cereuisiae homologous RAD52 genes, including chicken RAD52 (Bezzubova et al., 1993b), fission yeast Schizo- saccharomyces pombe RAD22 (Ostermann et al., 19931, and Kluyveromyces lactis RAD52 (Milne and Weaver, 1993) genes, show a highly conserved N-terminal amino acid sequence and a less homologous C-terminal sequence. However, the cloning of human and mouse homologs of the yeast RAD52 gene has not been re- ported. In this report, we identified two mouse cDNA frag- ments by mixed oligonucleotide primed amplification of cDNA (MOPAC) (Lee and Caskey, 1990; Shen et al., 1993). We cloned and sequenced the mouse and human cDNA homologs of yeast RAD52 genes using the identi- fied mouse fragment. The human RAD52 gene is as- signed to chromosome 12p12.2-p13 by fluorescence in situ hybridization (FISH). The mouse RAD52 mRNA level was also measured in several tissues. M TERI LS ND METHODS Materials. A human T-cell cDNA library in Lambda-ZAP Express Vector was purchased from Stratagene (La Jolla, CA). C3H lOT112 cell cDNA library in Lambda-ZAP II vector has been described (Shen et al., 1994). Mouse A9 cells and a panel of A9 cell hybrids that each contain a single human chromosome 1-8, 11, 12, 14-22, and Y (Koi et al., 1989) were kindly provided by Oshimura (Kanagawa Cancer Research Institute, Japan). Other CHO cell hybrids containing hu- man chromosomes 9, 10, and 13 were purchased from the NIGMS Human Genetic Mutant Cell Respository (National Institutes of Health). Human skin fibroblasts were established in this laboratory (Tsuboi et al., 1992). A mouse multiple tissue Northern blot was purchased from Clontech Laboratories, Inc. (Palo Alto, CA). A gel- extraction kit and plasmid mini- and midi-kits were purchased from Qiagen (Chatsworth, CA). [a-32P]dCTP (3000 Ci/mmol) was pur- chased from Amersham Corp. (Arlington Heights, IL). Mixed oligonucleotide primed amplification of cDNA. To amplify the RAD52 cDNA, an approach similar to that of Shen et al. (1993) was used. Two consecutive rounds of 35-cycle PCR were performed. The PCR reaction mix contained 0.1 vol (i.e., 2 ~1 for 20 ~1 of total reaction volume) of cDNA template; 0.2 pM dNTP; IX PCR reaction buffer (100 m&f Tris.HCl, pH 8.3; 500 mM KCl; 15 mM MgC12); 0.5 u/p1 Taq DNA polymerase (Perkin-Elmer Cetus Corp., Norwalk, CT); and 5 &f of both of the sense degenerate primers (Sl) and one of the antisense degenerate primers (either Al or A2) (see Results for more information about the degenerate primers). PCR was per- formed by annealing at moderate stringency at 52°C. For the first round of PCR, 0.1 vol of a Lambda-ZAP II cDNA library made from C3H mouse embryo fibroblast (titering: 1 x 10” plaque forming units (PFU)/ml) @hen et al., 1994) was used directly as the template cDNA. For the second round of PCR, 0.1 vol of the resultant first-round PCR products was used as template. The amplified mouse RAD52 cDNA fragment was cut from an agarose gel, purified with a Qiagen gel-extraction kit, and confirmed by direct DNA sequencing (see Results). This DNA was used as probe for the first round of screening of cDNA libraries (see below). Screening of cDNA libraries. One round of hybridization-based screening and two rounds of PCR-based screening were used to iso- late the human and mouse RAD52 cDNA clones from two separate cDNA libraries. A human T-cell cDNA library in Lambda-ZAP Express (purchased from Stratagene) and a Lambda-ZAP II mouse cDNA library that was constructed from C3H embryo fibroblast lOT1/2 cells (Shen et al., 1994) were screened with a Duralon-UV membrane (Stratagene) according to the manufacturer’s manual. The probe used in the hy- bridization was an -350-bp purified PCR fragment (see Results) of mouse RAD52 cDNA that was labeled with [a-32PldCTP by PCR as described previously @hen et al., 1993). The temperature of the hybridization screen for the mouse library was at high stringency (42°C) and for human at moderate stringency (37”C), with 50% for- mamide. For the first round of PCR screening, plugs containing putative RAD52 clones that had been identified from the above radioactive screen were plated at about 30-50 PFU per lOO-mm agar plate. The phages grown on each plate were pooled by eluting them with SM buffer (0.58% NaCl, 0.2% MgS04.H20, 50 m&f Tris.HCl (pH 7.51, 0.01% gelatin) and stored with 0.3% chloroform at 4°C. Two microli- ters of the pooled phage was subjected to PCR with two independent sets of PCR primers (see Results for primer information in PCR screen). For the second round of PCR screening, pooled phage from plates with positive PCR results from the first PCR screening were plated on lOO-mm agar plates at a density of 30-50 PFU per plate. About 30 plaques per agar plate were individually transferred into SM buffer as described above. Two microliters from each plaque was subjected to PCR. Positive phage clones were therefore isolated. Positive phage clones from the second-round PCR screening were subcloned into pBluescript plasmid (for Lambda-ZAP II vector) or pBK-CMV plasmid (for Lambda-ZAP Express vector) by employing the ExassistSOLR in uivo excision system or the Exassist/XLOLR in viva excision system (Stratagene) according to the manufacturer’s manual. DNA sequencing. A primer-walking strategy was used to se- quence cloned plasmid cDNA insert. Sequencing was performed with the Tuq DyeDeoxy Terminator Cycle Sequencing Kit and AI31 373A automatic DNA sequencer (Applied Biosystems Inc., Foster City, CA) according to the protocols provided by the manufacturer. Both strands of the DNA were sequenced at least once. Sequence editing was carried out with the SeqEd software (Applied Biosystems) on a Macintosh computer. Further sequence analysis was performed on a VAX computer using the GCG sequence analysis software package (University of Wisconsin, Madison, WI). Fluorescence in situ hybridization and R-banding. Fluorescence in situ hybridization was performed essentially as described else- where (Korenberg et al., 1993). A biotinylated human RAD52 cDNA clone in pBK-CMV was mixed with the human C&-l fraction and salmon sperm DNA to suppress repetitive sequences or block nonspe- cific hybridization. Hybridization was detected using successive rounds of fluorescein (FIT&avidin D and biotinylated goat anti- avidin D (Vector Laboratories, Burlingame, CA). Three applications of FITC-avidin were required for signal visualization. Chromosomes were R-banded using chromomycin A3 and distamycin (Sigma Chem- ical Co., St. Louis, MO) following hybridization and detection (Donlon and Magenis, 1983). Scoring was performed on a Zeiss Axioplan with 100X plan NEOFluar objective and a long bandpass filter (Zeiss filter pack 09: 450-490 nm excitation/FT 510-nm dichroic mirror/LP 520- nm barrier filter) to visualize FITC signals and R-bands simultane- ously. Northern hybridizations. A multiple-tissue Northern blot con- taining mouse heart, brain, spleen, lung, liver, skeletal muscle, kid- ney, and testis was purchased from Clontech Laboratories, Inc. This membrane was sequentially hybridized with mouse RAD52 cDNA, RAD51 cDNA, and human b-actin cDNA (provided with the blot). After autoradiography, hybridized probes were stripped off before the next hybridization. The probe for RAD51 cDNA was prepared by PCR amplification of the human Lambda-ZAP cDNA library (see Results for explanation of why RAD51 is also used for hybridization). Hybridization probes were labeled with a random labeling kit (Amer- sham). Other molecular methods. DNA purification from agarose gel and mini- and midi-plasmid isolation were performed using the Gel-ex-  HUMAN AND MOUSE RAD52 GENES 201 zyxwvut 622bp E 527bp 404bp 307bp B 240bp A zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA FIG 1. Amplification of mouse RAD52 cDNA. C3HlOT1/2 cell cDNA in Lambda-ZAP II phages was directly amplified with the degenerate primers (see text). A total of two rounds of 35 cycles were performed. Lane 1, amplification by primers Al and Sl; lane 2, DNA ladder; lane 3, amplification by Sl and A2. A total of 6 major bands were visible. Bands B and D have the predicted sizes for the corre- sponding primer sets and therefore were subjected to further analysis (see text). traction and plasmid isolation kits (Qiagen). Primers were synthe- sized with an Applied Biosystems Model 394 synthesizer. DNA isola- tion from cultured cells was performed as described (Sambrook et al., 1989). All PCR reactions were performed as described in MOPAC. However, only 2 $f primers were used in PCR when nondegenerate primers were used. RESULTS zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA Identification of Mouse RAD52 Gene Based on the conserved N-terminal amino acid of chicken (Bezzubova et al., 1993131, S. cerevisiae (Ad- zuma et al., 1984), and K. lactis (Milne and Weaver, 1993) RAD52 peptide, the following degenerate primes were synthesized: Sl, AA(A/G)(T/C)TIGGICCIGA(G/ A)TA(C/T)AT; Al, (G/A)(T/C)ICC(G/A)TAICCIA(T/C) (G/A)TC(T/C)TC; and A2, CA(G/A)TTICC(G/A/T/C)A (A/G)IGC(G/A)TTICC. Sl is a sense primer; Al and A2 are antisense primers. “I” indicates inosine. After two rounds of PCR amplification (see Materials and Methods), six major bands (three by pairing Sl with Al, three by pairing Sl and A2) were amplified (Fig. 1). The band lengths of B and D (Fig. 1) were close to the predicted sizes for the chicken and yeast RAD52 cDNAs for the corresponding primer sets. Therefore, bands B and D were purified for DNA se- quence analysis. We used the degenerate primers (Sl, Al, and A2) to sequence the purified bands B and D. The 5’ end se- quence of band D (Fig. 2, bases 273-591) overlapped the whole sequence of band B (Fig. 2, bases 273-480) as expected. High sequence homology between band D (excluding the primer region) and the chicken and yeast RAD52 genes led to the conclusion that bands D and B are amplified from a mouse RAD52 cDNA homo- log of the yeast and chicken genes. Sequences in the primer regions were not used for this comparison be- cause mismatches could occur using the degenerate primers at moderate stringency in PCR amplification @hen et al., 1993, 1994; Lee and Caskey, 1990). Specific primers were synthesized according to the sequence of band D and subsequently used for PCR screening of libraries in combination with the degener- ate primers. Preliminary experiments showed that these specific primers designed from the mouse cDNA and the degenerate primers were also able to amplify human cDNA under moderate PCR annealing strin- gency (data not shown). Presumably, this is because of the high sequence homology between human and mouse cDNA in this region, as will be discussed later. The mouse cDNA-specific primers were used for PCR screening of both mouse and human phage cDNA li- brary, as described under Materials and Methods. Cloning and Sequencing of Mouse RAD52 cDNA After one round of 32P hybridization screening and two rounds of PCR screening, two positive clones from -1.0 x lo6 PFU of C3H mouse Lambda-ZAP II cDNA library (see Materials and Methods) were purified and subcloned into pBluescript plasmid. DNA sequencing revealed that the longer mouse clone had a RAD52 insert of 1664 bp, as shown in Fig. 2. It had an open reading frame (bases 115-1374 in Fig. 2) that codes for 419 amino acids. Codon 115-117 was assigned as the translation start codon because it was the first ATG codon in the same frame and it had the characteristic A/G at the -3 position relative to ATG (Kozak, 1984). The shorter mouse clone had a 975-bp RAD52 insert corresponding to bases 51-1022 at the 5’ end (Fig. 2). We compared the two clones and found that the second 1 GGcGAoGAcr~AGcrrGcAGAGTcTccAmcm- cccrcTccGGcTTccc 61 zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIH GcAGGaCCcGGACcGAGcT- CCGCGTTCCGMGCGCGGTCMCATGGCT 121 181 241 301 361 421 481 541 601 661 721 701 lSXAACCATCCTCCC ~G GGCCTGAAGMGCAGTCCA- GPILAVIIRGCDNHPPPVGGK TCTGTCCTCCTCTITGGAC CAGCGGATGAATACCAGGCCATCCAGAU, GmmGAGACA AAGGToTolTATA zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQP ITGMGGTCATCGGGTAATTM~CCMlCAGATGTTl’2GlTAC KVCYIKGNRVINLANLWPGY AA-CACTCE TGTGGATllTGTl'GACCTCAACAATGGC NGWANSITPQNVDFVDLNNG MGTTcTAcoTGow GTCTGTO~~T~ffiTOC~C~AT~T KPYVGVCAFVKVQLKDGSYH AGGACGWZGGCT CGTTCAMGGCCTfGTCACTGGAGMG SKALSLEK G~~~~CN;T~~CG~~~~~AG ARKLAVTDGLKRALRS A~~~~CffiT~~~TMG~C~C~~G ILDKDYLRSLNKLPRQ ETECCTC?TOAn;TGWLmME-~GA~~C~T~GTAG~ LPLDVDLTKTKRKDPEPSVE CAGGCAAGATACAACA~CCGACAGMTGAAGCATTGGGA CTCCcCAAACCACAGGM QARYNSCRQNEALGLPKPQE OTOA~~F1TOOIOATCMOCCC~~~~~~~MG~~~G~ VTSPCRSSPPNDSNIKLCGA S41MOOAEaTOIOUIGCTCCn;C~~CffiC~C~GGA~G~AffiC~~~C~G KDISSSCSLAATLESDATHQ 901 AGGMGCECGGAA G~CCCCCACMG~GCTC~G~G~~CCG~M~~~AG RKLRKLRQKQLQQQPREQRE 961 ACTCGCCGGCAGAGCCATGCACCTGCCGAAGAGGTGGCAGCCAAGCATGCGGTACTTCCA TRRQSHAPAEEVAAKXAVLP 102lGCCCCTC-CACAGCACCCCTGTMCTGCAGCCTCAGMCTCCTCCAGGAGAAAGTC APPKHSTPVTAASELLQEKV 1081 GTCmCCAGATMCCCCTTGAM'WTGGGACCTTACTCCAGACTTAGAG VPPDNLEENLKKVDLTPDLE 114loACATCAnMGCCCmTGTAolCC~~~C~~~~C~C DIIKPLCRAEPAQTSATRTF 1201 MCAACCAGGACAGCGTCCCACATATCCATTGCCATCAGAMCCACU.GMAAGCCXGA NNQDSVPNINCNQKPQEKPG 1261 CCK;OOCAC~CACACC~~C~C~G~~~~A~TAG~G~MGA~~ PGHLQTCNTNQHVLGSREDS 1321 GAACCTCATAGG?AGAGCCAGGACCl’GAA BCTAGATCCATCCTGAGACTCA RPHRKSQDLKKRKLDPS+ 1301 AGATGTCACTAGACCGTCA-GGA CPFFGGAMACTGCAGTFTGGTCA-'FFGT 1441 TCCACCITGG CTCATGCTGMCTCTTTAGAGGA~ATAGAGGMGCTMCTACTTAAMA 1501 GGTmTCA TACCCCATGAWGGAA GGAGGCCAACAGATAAACTTTGTTCAGTATTACTCA 1561 CTCCTMGCKiATTCTAUiAC~~ffi~C~~~M~~~~~C~ 1621 GCCCCAoCAn;ACrGTTACn~~A~~~AC~~ FIG 2 cDNA sequence and derived amino acid sequence of the mouse RAD52 gene. The amino acid sequence is presented in single- letter code directly below the first nucleotide of the codon. The puta- tive poly(A) addition signal and addition site according to Birnstiel et al. (1985) are underlined. Positions used for degenerate primers are boxed.  202 SHEN ET AL. 1 ~TcMQATGT-~GGMGcMITcr?G NIIGTtBAILG zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA omparison of RAD52 Amino Acid Sequences 6lGAGGA~~CmcAGTGmAawnTGGAcAGTGcc GRD ~PAAGGG6VLCPGQCQ We used the BESTFIT program in the GCG package 191 AcT~ACUIOOCCLTCCILOLLOaCCC YT AilLYQA zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA QX ALROAG&z to list the overall amino acid sequence similarity be- 181 AATAaTAA6TAGCCGCAp ¶'I86RXAGGGQXVCYIIGXR tween human and other RAD52 polypeptides (Table 1). P41GGGTAA~AAxmGccAATGAGA ~ACAATGGClSGGCACACTCCATCACGC VtlLAllXNPGYllGYAli6ITG It is evident that mouse and human RAD52 have the a0lA6CAGMTGlU6ATlTTGllGACClCMCM~ACGTGGGA~T QIIVD zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA Q DLG;A~~~A~;~ best similarity and identity. All of the available RAD52 a61 --TGGTTCA VRPQLKDG6XIIIDVGYQV8L peptide sequences were aligned using the PILEUP pro- 611 A666CCM66M66AffiC66lVACAMC6 CLXS6AL6LB6AGKLAVTDG gram in the GCG software package (Fig. 4). It is evident 4.1~OCGAGCEClTGGMA~AlTCTGGACMAG LXRALR8PGNALGNCILDXD that all of the RAD52 peptides show a highly conserved 54lA~~~~~~~M~A YLRILIXLPRQLPLIVDLTX N-terminal amino acid sequence, especially from posi- 601 -TCllGAA ~OGAGGCAAGATACAACAQ~CCGAC AX1QDLIPEVLLARYllCRP tion 61 to position 210 (Fig. 4). At the C-terminus, little 6ClCClWCAQ cAGGTGACcrCccmCcA6A-cc tIllALGIPQLQPVT6P6RPSH homology between yeast and mammalian RAD52 was 7al A-TA CC6GCWACCCEC-CCTGAGCTCATCCGCCGTGG AVIPADQDC665l6L666AVE found. A noticeable R(K/R)xxxxKKR(KR) sequence at 781 -cAcGcAccAG ~CAGAAGCAGCTGCAGCAGCAGlTC~ 66ATIP6KLRQIQLQQQFRL the C-terminus is present in human, mouse, and 64lAGCGGATGGAGMQECGCCGTCAGCT'GAGAAGAGTGAGGCAG RNtXQQVRV6TP6AEK6EAA chicken, but not in yeast RAD52. This sequence is simi- ,Ol~CQGCEE~L~~~M~~~~C~~ lar to some of the reported nuclear localization signal PPAPPVTR6TPVTV6~PLLE 961 A CICMGAATTMTCMGACTCGACAA- (Roberts, 1989). XDTLAGVTQLLIXTLLDG6t loal -crcccGAv -GCCCTC KWAVTPDAGDGQVKP 6 6RAb lO8lACCCAGCCCAGACCMCCAGATGGlSACCCAGAACAGGA Human RAD52 Gene Is Located at Chromosome PAQT6DTLAL6IQXVTPWRT 1141 CTCCACA- CCAGAAACCACAAGCAAAATCTGGATClTGGGACCTCCAM 12p12.2-p13 PlI6VC6QRPQAKIC6WDLQT la01 CTTATAGCGCTGACCAA~CAACAGCAAACTGGGAA TCKATAGGAAGAGCCAGGACA Y6ADQITTQNYL6ERK6QDX Simultaneous R-banding and fluorescence in situ hy- 1161 ~TA~~T~M~~~~~C~~TM~~~ fRRKYDPl* bridization show that the human RAD52 gene is lo- ixal CAC TrGmcATcGcrGC 1381 TGAACGTCATl'GCAAllTA TTCTGAACCllATCAAGAGGAT~- cated at chromosome 12p12.2-p13 (Fig. 5). One hun- 144 AGcccAcIGcAGTcA --TCACTCTAGTAGGGAG 1SOlADC~C~~~~~~A~A~A~ dred metaphases were scored for FITC signal on both 156lGMC~~A~M~~~~C~C~ 1611 GCAATATAGGCCAGA~CCTMGCACCTGC -lTGTCTACAlTCAGTTGT chromatids of one chromosome at a single band posi- 168lm~~~M~~~~~M 1741 GCACTGTGGATCACGACA GAAMkGGTTGGAGCAGTGCmTEA CTACllTGTATCAAT tion. Hybridization of cDNA clones is less efficient com- 1801 CCACGETACAA- l’ITMTATAMTMTTTATUCAlTTATCACATTACAATCC2AC l,IlA~~~~~M~~TM~~M~C~~ pared with hybridization of cosmids or YACs, but more isai MCGCZG-T--m 19.1-TGCMACACAGCTCTCTCCACMCCWMWGC-TACT32 specific. Therefore, the presence of incompletely homol- aO4lCCIICCTCIOC~A~TA~~~A~~~Q~~~~C~ al01 AOGCATTTITGA MMCAAATCGTATAC-TAGAATATATATATAlTG ogous sequences may not be detected by this method. al61 CITATCTGAMTGCITGAAA CAGAATIGlTMGCATTlllTG TATITOTATACACAT aaai ~T6Ata -A-CCCGTSAWTCACCTGlGnTCGTCTAT Higher background is associated with the repeated am- aaU ATGTCTCATGCACATMTlT7GTCA7GAMCAGAGTXTT T TMGMGATACACXSC 1341 AWXGMGAooG-I-A-CATAMCTGTTCTATCCCT plification that is necessary for signal detection. There- a401 CCACTNTCACACGAWTCACS’XG~M~CCACTT~CATCA~ fore, individual FITC grains were disregarded in scor- a46l~~CTU~rCIC~~6~~~A~~~~~ asal nm~~crmxcc~m -l’GTMCCCACClTGACCATAMl7’WcZlTI’C ing cells. Of the 100 metaphases scored, paired signals aSB1 ATAQTGCTCAGATGTTTC were observed in only 20 metaphases, presumably due FIG. 3. cDNA sequence and derived amino acid sequence for the to the low efficiency of FISH with cDNA probe. Seven- human RAD52 gene. Symbols as in Fig. 2. teen paired signals occurred at the 12p locus, and the remaining signals each occurred once at three different clone has an A -+ G (resulting in Lys + Glu) transition loci. The signal on 12p occurred most frequently in the at base 697 (Fig. 2) and an insertion GCA (coding for R-positive terminal band (12p13), sometimes ap- Ala) between bases 1011 and 1012 (Fig. 2). These differ- pearing quite telomeric. However, because the chromo- ences may represent polymorphisms of the RAD52 gene somes of some metaphases were more condensed, or in C3H lOT1/2 cells. We compared the cDNA sequences banding less observable, signals could be interpreted as with the degenerate primers used to amplify mouse abutting the positive-negative interface with 12~12.2. cDNA and found only one mismatch in the degenerate The localization is therefore reported here as a range. A primer region of primer Sl. second hybridization on metaphases from an unrelated donor was used to confirm the localization. Cloning and Sequencing of Human RAD52 cDNA Two positive clones were isolated from -1.0 x lo6 PFU of the human T-cell cDNA library. The longer clone had an insert of 2598 bp (Fig. 3). The shorter clone had a RAD52 insert of 654 bp, with an identical sequence of bases O-641 in Fig. 3, plus an extra se- quence of GTGTGCACCGCGC at the 5’ end. Based on the same standard of Kozak (1984), codon 33-35 was assigned as the translation start codon. An open read- ing frame (bases 33-1289 in Fig. 3) that codes for 418 amino acids was identified. zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA TABLE 1 Amino Acid Comparison of Human IUD52 with Others Overall length Gaps Similarity (%) Identity (%I Mouse 431 9 80.5 71.7 Chicken 432 7 73.0 57.8 S. cerevisiae 501 12 51.0 30.8 K. lattice 438 11 51.8 30.5 5’. pombe 472 8 49.6 30.7  HUMAN AND MOUSE FtAD52 GENES zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPON 03 l.mul lZlL X.L. f:i: lAmon Ilou CAiCAOll X.L. I::: Ez ahkal K.L. 2:: iis c.i&r, ::5: 8-P. mmm i ZZlt K.L. B.C. S.P. I 50 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . nsa nMIIGaKo . . . . .-A- zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA ---vlR-c- . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..-PI uasKDsmsnY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . II-DYOS-KS nArl8Yr.Ts 4Q10111u Ens0swm maoiN-DI( o-XKPvr-Its . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .--P sQlcQHv.ss- iLkesas 100 -.Bcm.I~~NI- “--pR--I(- -L_-c_ 9-_-v-_ _P -w-m B-e -*-ye _ll--m--. + --I(- ---9_-_- mo....... . . . . . . . . . . . . . . .-+K -wK---- -x-VGP-SSK -P)....... . . . . . . . . . . . . . . ..-+K -OK+---- -x-WxeaK QsImlT.. . . . . . . . . . .-a CnlrL-88 -8KK -v -I-MP--PS 101 150 WZY-NAnmmYm QlwuRool vDrvDul..s - -____ - m-s- -me-_ __ ----__. -I(- -pm -“-- -----_*- -~b--c-- -.--4lS.---QI--D-Slmmmm I-L-P.4 -S-81-m-I I.--w----QI--m I-L-n..g -SI-cY-I -S---m- S--I-?- -SS-SSI- -S-K-S-KK- -KISL-LSVI 1s zoo YmwKmSYraDsmar owIIwLLKKKKSAYlwmSAxaScw -11------_- - -- ---ltc-_- -S-.-+‘P R-I-- -8.P R-K-S----. zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA S-4--- --e-me- R--I--er- -0A.c R-1(-8-. ---s--a--- ---m--~- zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA x--am xtau+-au- -Q-~--A ---a--- 101 zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA 5 .IaKaIDIDYmsImLm QLPL..mDL lmmmLuP svm.KYKsc - -s-m ---_.b- --*_-K-v.- -d---_-_ ___ .-_ . --QIpI-- .+p..-L-_ +~.---y-- *I-K.---~_ -LY- P-AKIO-VM P-DrD-as- rKP.DsLs-n -MmlvcMH -----LY- P-AKI~vKr DP-OrD-SW- rsPmKxs-8 -KYwYYJlssg s---N-Y ---rva-mP rTmmN-- mAmP..M -rxKK.QKYz 251 300 MnnAmNa I@lmmmP m.. . . . . . . . . . . . . . . . . . . . . . . . . . . -o-w--L-l P-K--4+8 -Pm...... . . . . . . . . . . . . . . . . . . . . LmaaPaK- QcmAPTa- T-m...... . . . . . . . . . . . . . . . . . . . . B-KNS -nlmmAv- -PPm.... . . . . . . . . . . . . . . ..TYKs EuammKM QLTmmml- MTmL.... . . . . . . . . . . . .YKIS SSl=mm?-B- ltMuLmmMuYAD8 UalIPvEm nuoon lmmo c.IcAan K.L. f:S: wtu noun c.lcRon X.L. S.C. S.P. mmon llauoa calc.on K.L. I.E. S.P. E alieon K.L. S.C. S.P. 301 350 . . . . . . . . . . .QxPASQScS SSSLSSMVS SSATSQ.. .n KIaQKQL.. . .DSS IKlmSK-I- -ScSLMTL- -w---ml.- -----... . .ASK m-m- -SNYD-S--- CD-Y-...- -----... *.dRrmQSm AP.Q-mSSS -SSSKT-... ..SQQ-DPm L-oMmrSo SYw~SSPIIuQ31-uamDurIp-SK-DoooLocsuarr, IIAauvAmTuI--uoDIy -pucIouoI-IuIPvQMmwv Ml 400 . .QaQYKu Ia.KgaYKYS mmmSKSS?PSPRmlSY?vTvSSPLLK . .-----4 --YKK-mlAP UmlMnl-v L---.K--- --MS8-a . . .----wQ --RPR--Ksv ---...-KQ- TAN-X--- -..-QQK-Ai -ST KS~IS DC-.. III --YVYAKAS ~~SlflnSS-~SKDPwAKQS-Y-SSSPSu01-~AKM SW-...... .urSm-SSS YmmPKma D-II(-maTPSPK?IMSAA 401 450 KDYIMVYQS LImr SwAv..YPm m....SwK ?SSKAoPAQY RW...... YPSW-S-L II-DL..-L I-.....II- -L&-S-- KS........ ..KY?.-DL- L-DI..IwR T-UKUICS- SASSPAW-P TmQnKDPIP IQ81I1Dpao .Q.Iml-..v DQmsTP-. n.rIu(B(oLa TSvaISS110 SSSIHWSYQ WlgIml-..v DQYTSmI.P.-VW-Sm- v YmawSmm SPSIW-811 m A-VLPIIK-8 451 500 ~mwKYnvJQ (pou.. . .ScSmL QTYSMaKm -A-KTY--.. ..-DSY-Ill -----I-.. . .P-PalL --cSTS-SVL OS-PSSSS- Y-R--~ SYS--PvSPA QmP-AuYa SSW-S---P -SSSXYSSP SmamsGY lTSS..SPYv ASPQTSAYSS SS.-YYT-ml TSSDSVY- WSSSQLSISC SSD-. . SUP B -IK-S -Q-SPVS-SS mImSK.811 Sm-..8... SISLI-YKKS UD-mSnSK 101 550 Sm... ww...... . . -BRcw --a....., . . Am... S-m...... . . AaLkSmPAP QLaP..... . . .QKmL SSHSmaPS .mYPPMAPS?APPS-wu?SSlmS1RIITw(IIozM GSPKIKPIAK BDImeS-OS Q-mlSSKml- -STuSSmm a*........ . ..*.*. 551 . . . . . . . . -* -. . . . . . . FIG 4. Alignment of other FZAD52 peptides with human W52 peptide. A dash indicates amino acids identical to human RAD52. A dot indicates a eao. K. L.. K. k&ice RAD52: S.C.. S. cereuisiae RAD52; S.P., S. pombe FWI22. The putative nuclear localization signal for human, mouse,and chicken is boxed. To confirm the localization of the RAD52 gene on chromosome 12, DNA from mouse A9 cell or CHO cell hybrids that each contain one human chromosome l- 22 or Y was used for PCR amplification of the human RAD52 gene. As shown in Fig. 4, there is a high degree of homology between human and mouse RAD52 in the N-terminal peptides. Therefore, two sets of indepen- dent primers outside the N-terminus conserved region were used to PCR amplify the human DNA in these hybrids (see Fig. 6 legend for details of the regions). Among all of the tested hybrids, PCR products identical to the total human DNA (positive control) were ampli- fied only from the mouse cell line that contains human chromosome 12. Figure 6 shows the agarose gel of the PCR product of some cell hybrids. Therefore, the PCR results confirmed that the RAD52 gene is located on human chromosome 12. Mouse mRNA Expression in Tissues RAD52 is highly expressed in chicken testis. To test whether this is the case in mouse, a mouse multiple Northern blot, which contained 2 pg of mRNA from mouse heart, brain, spleen, lung, liver, skeletal muscle, kidney, and testis, was hybridized with the mouse RAD52 cDNA probe (bases 135- 1486 of Fig. 2). Hybrid- ization results showed the following (Fig. 7): (1) A RAD52 mRNA species of -1.9 kb is present in all of the tested tissues. Considering that the average poly(A) size of mammalian mRNA is 200-300 bp, this result suggests that the mouse cDNA clone (Fig. 2) is a full- length (or at least close to full-length) copy of mouse RAD52 mRNA. (2) By normalizing with the ,0-actin mRNA level, the level of RAD52 in mouse testis is not significantly higher than others as detected in chicken RAD52 mRNA (Bezzubova et al., 1993b), nor is it higher in spleen/testis as detected in mouse RAD51 mRNA (Morita et al., 1993). This observation is differ- ent from what has been seen in chicken RAD52. How- ever, (3) an extra band of -0.85 kb is present in mouse testis tissue. Since only one mouse tissue membrane was used and no independent mouse tissue blots were tested, we used RAD51 to test whether this membrane is representative, because RAD51 is highly expressed in mouse spleen and testis (Morita et al., 1993). Hybrid- ization with RAD51 confirmed that it is highly ex- pressed in mouse spleen and testis (autoradiography not shown). Therefore, we believe that Northern hy- bridization results from this membrane are representa- tive of the RAD52 mRNA expression in these mouse tissues. DISCUSSION We cloned the mouse and human homologs of the yeast RAD52 gene using a PCR-based technique. The human and mouse RAD52 peptides share a significant degree of homology in their N-terminal region, sug- gesting the functional importance of this region. Mouse
Related Search
Similar documents
View more
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x