Allopurinol Attenuates Oxidative Stress and Cardiac Fibrosis in Angiotensin II‐Induced Cardiac Diastolic Dysfunction

Please download to get full document.

View again

All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
 6
 
 

Design

  AIMS: Oxidative stress and fibrosis is implicated in cardiac remodeling and failure. We tested whether allopurinol could decrease myocardial oxidative stress and attenuate cardiac fibrosis and left ventricular diastolic dysfunction in angiotensin II
Share
Transcript
  RESEARCH Allopurinol Attenuates Oxidative Stress and Cardiac Fibrosisin Angiotensin II-Induced Cardiac Diastolic Dysfunction Nan Jia, 1 , 2 Peixin Dong, 3 Ying Ye, 1 Cheng Qian 2 & Qiuyan Dai 2 1 Ruijin Hospital, Shanghai Institute of Hypertension, Shanghai Jiao Tong University Medical School, Shanghai, China2 Department of Cardiology, Shanghai Jiao Tong University Affiliated First People’s Hospital, Shanghai, China3 Hospital and Institute of Obstetrics and Gynecology, Fudan University Shanghai Medical College, Shanghai, China Keywords Allopurinol; Diastolic dysfunction; Fibrosis;Oxidative stress; TGF- β 1. Correspondence Nan Jia, M.D., Ph.D., Ruijin Hospital, ShanghaiInstitute of Hypertension, Shanghai Jiao TongUniversity Medical School, China 200025.Tel.: + 86-21-6324-1377;Fax: + 86-21-6324-3749;E-mail: jiananchina@hotmail.comdoi: 10.1111/j.1755-5922.2010.00243.x SUMMARY Aims:  Oxidative stress and fibrosis is implicated in cardiac remodeling and failure. Wetested whether allopurinol could decrease myocardial oxidative stress and attenuate car-diac fibrosis and left ventricular diastolic dysfunction in angiotensin II (AngII)-induced hy-pertensive mice.  Methodology:  We used 8-week-old male C57BL/6J mice, in which an-giotensin II was subcutaneously infused for 4 weeks to mimic cardiac remodeling and fibro-sis. They were treated with either normal saline or allopurinol in daily doses, which did notlower blood pressure.  Results:  Allopurinol improved diastolic dysfunction in angiotensinII-induced hypertensive mice, which was associated with the amelioration of cardiac fibro-sis. However, allopurinol showed no effect on the increased systolic blood pressure by an-giotensin II infusion. The ratio of reduced glutathione (GSH) to oxidized glutathione (GSSG)[GSH/GSSG] was decreased and malondialdehyde levels were increased in the hearts ofAngII-treated mice. Allopurinol also inhibited both the decrease in the GSH/GSSG ratio andthe increase in malondialdehyde levels in the heart. Infusion of AngII-induced upregula-tion of transfer growth factor (TGF)- β 1, Smad3 expression and downregulation of Smad7expression. Treatment with allopurinol reduced cardiac levels of TGF- β 1, Smad3, and in-creased Smad7 expression.  Conclusions:  These results suggest that allopurinol preventspathological remodeling of the heart in AngII-induced hypertensive mice. The antioxidativeeffect of allopurinol contributes to the regression of AngII-induced cardiac diastolic dys-function. These effects of allopurinol to prevent cardiac fibrosis are mediated at least partlythrough modulation of the TGF- β 1/Smad signaling pathway. Introduction Hypertension significantly contributes to cardiovascular morbid-ity and mortality by causing substantial structural and functionaladaptations, including left ventricular diastolic dysfunction. Nearly50% of all patients with chronic heart failure have diastolic dys-function with high morbidity and mortality rates. Diastolic heartfailure (DHF) is a significant healthcare problem. Diastolic dys-function may well precede development of left ventricular hy-pertrophy in hypertension and possibly is characteristic of an im-portant pathophysiologic link between hypertension and heartfailure with preserved ejection fraction [1]. No specific therapeu-tic regimen has shown to benefit patients who have heart failurewith preserved ejection fraction, and thus there is a need to un-derstand the potential mechanisms primarily responsible for thisclinical syndrome. On the other hand, there are few studies thatprovide any guidance or instruction in the treatment of this pa-tient population. The pathophysiology and treatment of DHF ispoorly understood. The angiotensin II-induced hypertensive micehas been used as a model for investigating the characteristics ofmyocardial hypertrophy, the transition to heart failure, and has been proposed as a model for studying DHF, because it has beenestablished that early in the course of hypertension heart failureoccurs, whereas ejection fraction (EF) remains preserved [2]. Ox-idative stress is an important contributor to pathological remodel-ing in the failing heart [3]. Allopurinol is a xanthine oxidase (XO)inhibitor that blocks the superoxide production generated in theXO system. Recent reports indicate that chronic treatment withallopurinol in rodent models of postinfarction HF prolongs sur-vival, improves contractile function and attenuates left ventricular(LV) remodeling [4]. These benefits occurred together with sup-pression of the enhanced XO activity, superoxide generation, andoxidative protein modifications seen in HF. Although the benefitsof allopurinol are thought to be secondary to XO inhibition, othermechanisms may also be operative such as allopurinol-mediatedhydroxyl radical scavenging and suppression of uric acid levels c  2010 Blackwell Publishing Ltd Cardiovascular Therapeutics 30 (2012) 117–123  117  Allopurinol Attenuates Oxidative Stress and Cardiac Fibrosis  N. Jia  et al. and concomitant inflammatory activation [5]. However, it hasremained unknown whether allopurinol improves diastolic dys-function in AngII-induced cardiac hypertrophy. In this study, wehave investigated the effects of allopurinol on myocardial oxida-tive stress and cardiac fibrosis in the LV myocardium. We also ex-amined the expression of TGF- β 1 and Smad, which have pivotalroles in the development of AngII-induced cardiac fibrosis. Materials and Methods Animals and Treatment In our study, all animal protocols were approved by our Insti-tutional Animal Care and Use Committee. Eight-week-old maleC57BL/6Jwild-typemice(n = 44)werepurchasedandgivenstan-dard laboratory chow and tap water ad libitum. The mice wererandomly divided into four groups and were treated over a 4-weekperiod. Each of the four groups received the following treatment:oralnormalsalineandsalinepump(control;n = 11),oralallopuri-nol (Allo; 30 mg/kg per day of body weight; E. Merck, Darmstadt,Germany) and saline pump (Allo; n = 11), oral normal saline andangiotensin II (AngII; 2 mg/kg per minute) pump (AngII; n = 11),and oral allopurinol (Allo; 30 mg/kg per day of body weight) andAII (2 mg/kg per minute) pump (AngII + Allo n  =  11). The micewere anesthetized with 0.01 mL/g of a mixture of ketamine andxylazine prior to subcutaneous placement of a miniosmotic pump(Alzet model 2004, DURECT Corporation, Cupertino, USA). Themice were fed either normal saline or allopurinol daily by meansof gavage. Blood Pressure and Heart Rate Systolic blood pressure (SBP) and heart rate (HR) measurementswere made at the end of the study using a tail-cuff system (Vis-itech Systems, Apex, NC, USA). A minimum of five preliminarycycles were performed before collecting 10 measurements for eachmouse. Echocardiographic Analysis Transthoracic echocardiography was performed at the end of thestudy using an EUB 8000 echocardiographic instrument (Hitachi-Medico, Tokyo, Japan). Mice were anaesthetized with pentobarbi-turate(70mg/kg,i.p.).End-diastolicleftventricularinternaldiam-eter (LVDd), end-systolic left ventricular internal diameter (LVDs)and left ventricular posterior wall thickness (PW) were measured.To estimate the cardiac systolic function, percentage fractionalshortening (FS%) was calculated as follows:FS% = ((LVDd − LVDs) / LVDd) × 100 . The left lateral position was used to obtain an optimal Dopplerimage quality. The LV inflow tract was interrogated from the api-cal four-chamber view with the sample volume at the tips of themitral leaflets. The E wave velocity (E/A) ratio and isovolumic re-laxation time (IRT) were measured as estimates of the cardiac di-astolic function. Histomorphological Investigations For histological analysis, hearts were fixed with 10% formalin byperfusion fixation. Fixed hearts were embedded in paraffin, sec-tioned at 4  µ m and stained with Masson’s trichrome (MT) to en-able investigation of the overall morphology and fibrosis. The my-ocyte cross-sectional area (CSA) was determined in 50 cells peranimal from the left ventricular lateral-mid free wall (includingepicardial and endocardial portions), which were chosen at ran-dom. The collagen fraction was calculated as the ratio of the sumof the total area of interstitial fibrosis to the sum of the total con-nective tissue area plus the myocyte area in the entire visual fieldof the section. Approximately 40 arterial cross-sections were ex-amined in each heart [6]. Assay of Oxidative Stress LV homogenates were used for assay. The tissue level of total glu-tathione (reduced glutathione/oxidized glutathione [GSH/GSSG])in the LV was determined by the glutathione reductase and 5,5V-dithiobis-(2-nitrobenzoic acid) recycling assay. The amount ofGSSG was determined by Griffith’s method. The activity of glu-tathioneperoxidase (GPx) wasdeterminedbyusinghydrogenper-oxide as the substrate, and the rate of disappearance of NADPHwas recorded spectrophotometrically (340 nm) at 37 ◦ C. The lipidperoxide content of the LV was determined by estimation of mal-ondialdehyde (MDA) contents. Myocardial tissues were homog-enized in phosphate-buffered saline (pH 7.4) containing buty-lated hydroxytoluene (4 mmol/L). MDA was determined usingthe Bioxytech MDA assay kit (BIOXYTECH MDA-586, Oxis In-ternational, Portland, OR). RNA Extraction and Real-Time QuantitativeReverse Transcription–Polymerase ChainReaction RNA was isolated according to the TRIZOL protocol (GibcoLife Technologies, Gaithersburg, MD, USA). The RNA was dis-solved in diethylpyrocarbonatetreated water, quantified spec-trophotometrically at 260 nm and stored at  − 80 ◦ C. Reversetranscription–polymerase chain reaction (RT-PCR) of left atrialsamples of mice was performed according to the Omniscript Re-verse Transcription Handbook (Qiagen, Hilden, Germany). Themouse primers and probes used for quantification of TGF- β 1,Smad3, Smad7 and glyceraldehyde-3-phosphatedehydrogenase(GAPDH), as an internal control, were designed according tothe manufacturer’s instructions (Applied Biosystems, Foster City,CA, USA). The following primers were used: TGF β 1 forwardprimer GCTAATGGTGGACCGCAACAACG, TGF β 1 reverse primerCTTGCTGTACTGTGTGTCCAGGC; Smad3 forward primer GGGC-CTACTGTCCAATGTCAA, Smad3 reverse primer CGCACAC-CTCTCCCAATGT; Smad7 forward primer CTGACGCGGGAAGTG-GAT, Smad7 reverse primer TGGCGGACTTGATGAAGATG;GAPDH forward primer GCCCATCACCATCTTCCAG, GAPDH re-verse primer TGAGCCCTTCCACAATGCC. Real-time quantitativeRT-PCR was performed with an ABI PRISM7700 Sequence Detec-tion System (Applied Biosystems) by the relative standard curve 118  Cardiovascular Therapeutics 30 (2012) 117–123  c  2010 Blackwell Publishing Ltd  N. Jia  et al.  Allopurinol Attenuates Oxidative Stress and Cardiac Fibrosis method. The target amount was determined from the relativestandard curves constructed with serial dilutions of control totalRNA. Statistics Data are presented as the mean  ±  SEM. Comparisons betweengroups were made by one-way anova, followed by Fischer’s leastsignificance post hoc test or Student’s unpaired  t  -test.  P   <  0.05was considered significant. Results Systolic Blood Pressure and HR The effects of treatment on SBP and HR are summarized inTable 1. Angiotensin II treatment increased SBP in mice and al-lopurinol treatment did not reduce the AngII-induced increase inSBP. There were no significant differences in HR between the fourgroups. Cardiac Function and Remodeling To investigate cardiac function, we performed echocardiographicexaminations; results are given in Table 2. Left ventricular hyper-trophy (LVH), as determined by PW, was clearly induced by AngIItreatment of mice. This AngII-induced LVH was clearly inhibited by allopurinol treatment of mice. The end-diastolic LV diameterand LVDs did not differ between any of the groups. Left ventric-ular systolic function was measured as FS%. The values for nor-mal FS% in mice were consistent with those in previous reports[7] and there were no significant differences in FS% between thefour groups. However, the E/A ratio was reduced and c-IRT wasprolonged in the AngII group, indicating that there was some ev-idence of diastolic dysfunction after angiotensin II administration.Finally, the data show that allpurinol treatment did improve thediastolic dysfunction caused by administration of angiotensin II.Left ventricular weight/bodyweight (LVW/BW) ratios are given inTable 1. Angiotensin II treatment of mice increased the LVW/BW Table 1  Bodyweight, systolic blood pressure, heart rate, left ventricularweight: bodyweight ratio, myocyte cross-sectional areaControl Allo AngII AngII + AlloBodyweight (g)Before 27.5 ± 0.5 27.7 ± 0.7 27.6 ± 0.7 27.4 ± 0.6At 4 weeks 30.7 ± 0.6 29.3 ± 0.7 28.9 ± 0.5 29.8 ± 0.4SBP (mmHg) 108.7 ± 2.3 110.2 ± 3.5 139.7 ± 1.6 ∗ 140.1 ± 2.6 ∗ HR (b.p.m.) 550 ± 17 557 ± 15 568 ± 16 559 ± 25LVW/BW (mg/g) 3.0 ± 0.3 3.1 ± 0.2 4.2 ± 0.1 ∗ 3.8 ± 0.2 ∗ † Myocyte CSA 167.7 ± 7.3 165.6 ± 9.5 210.8 ± 10.2 ∗ 208.1 ± 8.6 ∗ † ( µ m 2 )Valuesarethemean ± SEM(n = 11ineachgroup). ∗ P < 0.05comparedwiththe control and the allopurinol (Allo) group;  † P  <  0.05 compared with theangiotensin (Ang) II group. SBP, systolic blood pressure; HR, heart rate;LVW/BW, left ventricular weight: bodyweight ratio; CSA, cross-sectionalarea. Table 2  Echocardiographic measurementsControl Allo AngII AngII + AlloPW (mm) 0.47 ± 0.04 0.46 ± 0.05 0.89 ± 0.09 ∗ 0.68 ± 0.07 ∗ † LVDd (mm) 3.13 ± 0.16 3.11 ± 0.17 3.07 ± 0.13 3.05 ± 0.16LVDs (mm) 1.53 ± 0.15 1.48 ± 0.16 1.49 ± 0.13 1.47 ± 0.12FS% 51.61 ± 1.41 51.81 ± 1.33 51.72 ± 1.42 52.51 ± 1.22E/A ratio 2.647 ± 0.152 2.629 ± 0.212 2.207 ± 0.153 ∗ 2.573 ± 0.437 † c-IRT 0.12 ± 0.01 0.12 ± 0.02 0.16 ± 0.02 ∗ 0.11 ± 0.03 † (msec)Values are the mean ± SEM (n = 11 in each group).  ∗ P  <  0.05 comparedwith the control and the allopurinol (Allo) group;  † P < 0.05 compared withthe angiotensin (Ang) II group. PW, posterior wall thickness; LVDd, end-diastolicleftventricularinternaldiameter;LVDs,end-systolicleftventricularinternaldiameter;E/Aratio,Ewavevelocityratio;FS%,percentagefractionalshortening; c-IRT, cardiac isovolumic relaxation time. ratio. The AngII-induced increase in the LVW/BW ratio was sig-nificantly inhibited by Allopurinol treatment. In addition, AngIItreatment increased myocyte CSA in mice and, allopurinol treat-ment did not reduce this AngII-induced increase (Table 1). Cardiac Fibrosis Representative photomicrographs of the heart are shown inFigure 1. Interstitial fibrosis was significantly increased afterAngII treatment in mice and treatment with allopurinol almostcompletely abolished the AngII-induced increase in interstitialfibrosis. Myocardial Oxidative Stress The GSH/GSSG ratio was decreased and MDA levels were in-creased after AngII treatment in mice, indicative of increased my-ocardial oxidative stress (Figure 2A, B). However, both the GSHcontent and the activity of GPx remained unchanged in thesehearts (Figure 2C, D). Treatment of mice with allopurinol inhib-ited both the decrease in the GSH/GSSG ratio and the increase inMDA levels in the heart. Treatment with allopurinol did not affectmyocardial GSH content or GPx activity. Expression of TGF- β 1, Smad3, and Smad7 mRNA To investigate whether AngII treatment stimulates the signalingcascade leading to cardiac fibrosis, we investigated mRNA levels ofTGF- β 1, Smad3 and Smad7 in the heart. The results are shown inFigure 3. Following AngII treatment of mice, TGF- β 1 and Smad3mRNA levels in the heart were significantly upregulated, andSmad7 mRNA level was significantly downregulated. Treatmentof mice with allopurinol completely prevented the AngII-inducedchanges in expression of TGF- β 1, Smad3, and Smad7 mRNA. Discussion The present study demonstrated that allopurinol can improvecardiac diastolic dysfunction and remodeling in angiotensin c  2010 Blackwell Publishing Ltd Cardiovascular Therapeutics 30 (2012) 117–123  119  Allopurinol Attenuates Oxidative Stress and Cardiac Fibrosis  N. Jia  et al. Figure 1  Left ventricular interstitial fibrosis in mice. ( A ) Representative images of the myocardium with interstitial fibrosis stained with Masson trichromestain. ( B ) Bar graph showing the quantified interstitial fibrotic area (%). Values are the mean ± SEM. (n = 11) ∗ P < 0.05 compared with control and allopurinol(Allo);  † P < 0.05 compared with angiotensin (Ang) II. II-induced hypertensive mice. These beneficial effects of allopuri-nol were independent of blood pressure decrease and were associ-ated with attenuating oxidative stress and fibrosis. These findingssuggest the potential involvement of TGF- β 1, Smad3, and Smad7in regulation of the following process.An increase in the level of oxidative stress is implicated in thepathogenesis of heart failure [8], and fibrosis is thought to playan important role in the progression of cardiovascular diseases[2]. Treatments that reduce the levels of oxidative stress or fibro-sis have thus been found to improve hemodynamic function inpatients with advanced heart failure as well as in animal mod-els of this condition [9]. Allopurinol ameliorated increases in af-terload and reductions in myocardial contractility during evolv-ing heart failure, thereby preserving ventricular–vascular cou-pling [10]. In recent murine and rat heart failure studies, inves-tigators have demonstrated reduction of reactive oxygen speciesproduction and decreased myocardial dysfunction followingallopurinol treatment [11,12]. Importantly, in addition to the ben-eficial effect of the drug on left ventricular contractile function,allopurinol treatment also attenuated left ventricular cavity dila-tion and reduced myocardial hypertrophy and intestinal fibrosis[4,13]. Although no previous data are available regarding the ef-fect of allopurinol on diastolic dysfunction and cardiac remodel-ing in angiotensin II-induced hypertensive mice, our findings thatallopurinol has cardioprotective effects on left ventricular func-tion are consistent with these results in other murine modelsof cardiac failure. Previous studies reported reduction of oxida-tive stress and cardiac fibrosis was independent of blood pressurechanges. In this study, oxidative stress and fibrosis but not bloodpressure is attenuated by allopurinol in angiotensin II-inducedhypertensive mice. Our findings highlight the complexities inrelation of hypertension to cardiac remodeling and suggest thathypertension may involve mechanisms other than oxidative stress[14,15].Oxidative stress is an important contributor to pathological re-modeling in the failing heart [16]. Oxidative stress plays a criticalrole in cell growth, stress responses, and programmed cell death,processes intimately involved in the progression of pathologicalmyocardial remodeling [17]. However, the precise role of oxida-tive stress in the improvement of DHF, by allopurinol, is not de-fined. Therefore, in the present work, we examined the effect ofallopurinol on cardiac oxidative stress in angiotensin II-inducedhypertensive mice with DHF. Oxidative stress in the myocardiumreflects a shift in the balance between GSH and GSSG, and exces-sive production of reactive oxygen species (ROS) induces a reduc-tion of the GSH/GSSG ratio [18]. Both GSH and GPx have beenshown to be important cellular antioxidants, protecting cells fromthe damaging effects of oxidation products such as lipid peroxida-tion [19]. MDA is an end-product in the lipid peroxidation chainreaction and is frequently used as a marker for ROS production[20]. In the present study, both the GSH content and GPx activitywereunalteredintheheartofAngIItreatment,suggestingthatan-tioxidantcapacityremainedpreserved.Treatmentwithallopurinolattenuated the decrease in the GSH/GSSG ratio and the increasein MDA levels in the heart, whereas myocardial GSH content andGPx activity were not affected by this drug. These data suggestthat the antioxidative effect of allopurinol was brought by reduc-ing XO-derived generation of ROS in the heart.Transforming growth factor- β 1 (TGF- β 1) is a powerful initiatorfor the synthesis of collagens and other major extracellular matrix 120  Cardiovascular Therapeutics 30 (2012) 117–123  c  2010 Blackwell Publishing Ltd  N. Jia  et al.  Allopurinol Attenuates Oxidative Stress and Cardiac Fibrosis Figure 2  The reduced glutathione (GSH)/oxidized glutathione (GSSG) ratio,GSH content, and the activity of glutathione peroxidase in the left ventricleof mice. ( A ) The GSH/GSSG ratio. ( B ) Myocardial malondialdehyde levels.Results are expressed as nmol/mg of protein. ( C ) Myocardial GSH content.Results are expressed as  µ mol/mg of protein. ( D ) Myocardial GPx activity.ResultsareexpressedasmU/mL/mgofprotein.Valuesarethemean ± SEM(n = 11).  ∗ P  <  0.05 compared with control and allopurinol (Allo);  † P  <  0.05compared with angiotensin (Ang) II. components in many organ systems [21]. Evidence supports thatTGF- β 1, produced mainly by cardiac fibroblast and myofibroblastin the heart, contributes to the development of cardiac fibrosisand hypertrophy [22]. It has been shown that the expression ofTGF- β 1 mRNA is increased in the left ventricular myocardium ofpatients with idiopathic hypertrophic cardiomyopathy or dilatedcardiomyopathy and in animals after myocardial infarction [23].Downregulation of the TGF- β 1 expression suppressed myocardialfibrosis [24]. Accordingly, selective antagonism of TGF- β  was alsofound to be associated with a regression of diastolic dysfunction[25]. The TGF- β 1 signaling can be transmitted through the Smadprotein family. Three groups of Smads have been identified. Thereceptor-regulated Smads and common mediator Smad transducethe TGF- β 1 signaling to cell nucleus. Smad 7, an inhibitory Smad,can form a stable binding complex with the activated TGF- β 1 re-ceptor. This binding prevents the receptor activation of R-Smads[26]. It has been shown that the reduced Smad 7 expression con-tributes to the development of cardiac fibrosis in rats after my-ocardial infarction. TGF- β  favors fibrosis through the binding toits receptor and activation of the Smad3 signaling pathway, whichsequentially enhances matrix protein and TIMP expression [27].Smad3 loss prevents interstitial fibrosis in the noninfarcted my-ocardium and attenuates cardiac remodeling. The TGF- β 1/Smad3pathway is activated in healing infarcts and may regulate cellularevents critical for the fibrotic responses. In agreement with theseresults, in the present study mice with AngII-induced cardiac dias-tolic dysfunction not only expressed high levels of cardiac TGF- β 1and Smad3, but also exhibited decreased levels of cardiac Smad7.Allopurinol treatment downregulated TGF- β 1 and Smad3 expres-sion as well as upregulated Smad7 expression in AngII-treatedmice. These effects were associated with a significant lowering ofcardiac fibrosis.In conclusion, allopurinol prevents pathological remodeling ofthe heart in AngII-induced hypertensive mice. The antioxidativeeffect of allopurinol contributes to the regression of AngII-inducedcardiac diastolic dysfunction. It is possible that the effect of al-lopurinol to prevent cardiac fibrosis is mediated, in part, via theTGF- β 1/Smad pathway. c  2010 Blackwell Publishing Ltd Cardiovascular Therapeutics 30 (2012) 117–123  121
Related Search
Similar documents
View more
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x